<LinkableSection id={"overview"} title={"Overview"}>

On this page, we describe how to format custom sequence information for common **Xenium v1** and **Xenium Prime** advanced custom targets. Please send the files associated with these targets to your 10x bioinformatics representative.

<SupportCallout level={"warning"}>
<Text as={"span"}>
{"While no impact on assay performance is anticipated, 10x Genomics does not support or experimentally validate the use of custom probes, and thus cannot guarantee that custom probes will successfully detect their targets."}
</Text>
</SupportCallout> 

This is part of the [advanced workflow](/support/software/xenium-panel-designer/latest/tutorials/xenium-panel-design-workflow-guide#advanced) to request species standalone or advanced custom panels. Guidance is provided below for the following advanced targets:

- Single nucleotide variants
- Indels
- Gene isoforms
- Exogenous genes
- T cell receptors
- Barcode detection

</LinkableSection>

<LinkableSection id={"snv"} title={"Single nucleotide variants"}>

SNV performance will vary due to the ligation junction preferences of the ligase used in the Xenium In Situ assay workflow. Preferred ligation junctions are described in the [Species Standalone Custom and Advanced Custom Panel Design for Xenium In Situ Technical Note](/support/in-situ-gene-expression/documentation/steps/panel-design/species-standalone-custom-and-advanced-custom-panel-design-for-xenium-in-situ). Provide a FASTA file with exonic sequences. Here is an example FASTA file for specifying the KRAS G12D mutation:

```
>NM_004985 KRAS-CDS-sequence
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAA
TTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGA
TGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAG
TACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTC
ACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAA
ATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCT
TTTATTGAAACATCAGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTC
GAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAAT
TATGTAA
```

Additionally, provide a separate CSV file describing the single nucleotide variants you would like to target. This file should use 0-based coordinates in the position (`pos`) column, with each alternative base in the `alt` column (one row per alternative base). In the example below, `pos = 34` indicates the **35th base** of the sequence above in a **0-based coordinates system**, where the SNV is an A instead of a G:

```
sequence,pos,alt
NM_004985,34,A
```

An example of the designed probes aligned to the [human GRCh38 reference transcriptome](/support/software/cell-ranger/downloads/cr-ref-build-steps#human-ref-2020-a) is shown below:

<Image src={'https://cdn.10xgenomics.com/image/upload/v1706058105/software-support/Xenium-panels/advanced_custom_SNV_example.png'}/> 

</LinkableSection>

<LinkableSection id={"indel"} title={"Indels"}>

Provide a FASTA file with exonic sequence. Here is an example:

```
>indel
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCGGTCTCGATGTTGTCAATATTCCCCCAAGAACCCTTCTGGACAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
```

Additionally, provide a CSV file to define insertions and deletions. The file should have four columns: `sequence`, `start`, `end`, and `alt`. The alternative sequence should be left-padded and the positions should be **0-based**. For example, the CSV file should look like this:

```
sequence,start,end,alt
indel,42,43,TAA
indel,41,43,
indel,21,51,
```

Here are three scenarios illustrating how 10x will design the probes for Xenium v1 using the example FASTA and CSV above:

1. **Short insertion:** This adds an AA at position 42. We left-pad the sequence with TAA, which results in this design:

 ```
 seq: GCATGCATGCATGCATGCGGT CTCGATGTTGTCAATATTCC
 WT probe: GCATGCATGCATGCATGCGGT CTCGATGTTGTCAATATTC
 ALT probe: CATGCATGCATGCATGCGGTAACTCGATGTTGTCAATATT
 ```

2. **Short deletion:** This deletes a GT. The `alt` column is empty.

 ```
 seq: TGCATGCATGCATGCATGCGGTCTCGATGTTGTCAATATTCC
 WT probe: CATGCATGCATGCATGCGGTCTCGATGTTGTCAATATTCC
 ALT probe: TGCATGCATGCATGCATGCG CTCGATGTTGTCAATATTCC
 ```

3. **Large deletion:** This removes 30 bp (upper case represents the deletion region).

 ```
 seq: agagagccttgaggaaaaccaGCGGAACCTCCTTCAGATGACTGAAAAGTTcttccatgccatcatcagttc
 WT probe: gagagccttgaggaaaaccaGCGGAACCTCCTTCAGATGA
 ALT probe: gagagccttgaggaaaacca cttccatgccatcatcagtt
 ```

</LinkableSection>

<LinkableSection id={"isoform"} title={"Gene isoforms"}>

Please supply a FASTA file with the sequence of each splice junction you want to target, where the splice junction is centered and there are at least 40 bases of **transcribed sequence** on both sides in **transcription orientation**.

Here is an example FASTA file for specifying probes for the human EGFRvIII variant, where exon 1 aberrantly splices to exon 8.

```
>EGFR_exon1_exon8
GCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAATTATGTGGTGACAGATCACGGCTCGTGCGTCCGAGC
>EGFR_exon1_exon2
GCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAGTTGGGCAC
```

These sequences are 80 bp in total length with the splice junction in the center.

<Image src={'https://cdn.10xgenomics.com/image/upload/v1706058105/software-support/Xenium-panels/advanced_custom_isoform_example.png'}/> 

The above FASTA file is aligned to the [human GRCh38 reference transcriptome](/support/software/cell-ranger/downloads/cr-ref-build-steps#human-ref-2020-a). Each sequence is evenly split over the target splice junctions. Note that the sequences are in transcription orientation and only contain exonic sequence.

</LinkableSection>

<LinkableSection id={"exogenous-genes"} title={"Exogenous genes"}>

Exogenous genes include _protein tags, fluorescent reporters, transgenes, or expressed sequences such as CRISPR guides_. All of these genes can be specified by providing a FASTA file of the sequence you would like to target. Here is an example FASTA file for [GFP](https://www.ncbi.nlm.nih.gov/nuccore/L29345.1):

```
>L29345.1 Aequorea victoria green-fluorescent protein (GFP) mRNA, complete cds
TACACACGAATAAAAGATAACAAAGATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTT
GTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACAT
ACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCAC
TACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAG
AGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACAC
GTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGA
AGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGCAGAC
AAACCAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAG
CAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTC
CACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACA
GCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAAATGTCCAGACTTCCAATTGACACTAAAG
TGTCCGAACAATTACTAAATTCTCAGGGTTCCTGGTTAAATTCAGGCTGAGACTTTATTTATATATTTAT
AGATTCATTAAAATTTTATGAATAATTTATTGATGTTATTAATAGGGGCTATTTTCTTATTAAATAGGCT
ACTGGAGTGTAT
```

</LinkableSection>

<LinkableSection id={"tcell-rec"} title={"T cell receptors"}>

T cell receptor (TCR) detection in Xenium In Situ can come in one of two general flavors: 1) detection of Complementarity-Determining Region 3 (CDR3) sequences or 2) unbiased profiling of V/J segments. Unbiased V/J profiling is actively being developed by 10x Genomics, but is not currently available.

CDR3 sequence detection relies on using an assembled CDR3 sequence to design probes specific for the target CDR3 (such as one produced by the [10x Immune Profiling solution](/support/single-cell-immune-profiling)). By doing this, we make the assumption that there are no other CDR3 present at appreciable levels in the sample that have close sequence similarity.

If you want to target known CDR3 sequences, please provide a FASTA file containing the CDR3. You may wish to also include some flanking sequence from framework regions (FWR3/FWR4) to ensure an optimal probe is picked.

For example, this [representative PBMC dataset](/datasets/human-pbmc-from-a-healthy-donor-10-k-cells-v-2-2-standard-5-0-0) contains assembled CDR3 sequences that range from 42 bp to 48 bp. Here is an example assembled clonotype:

| Type | Sequence |
| ------- | ------------------------------------------------------------------------------------------------------------ |
| Barcode | TATCAGGCACGCGAAA-1 |
| FWR3 | ACTGACCAAGGAGAAGTCCCCAATGGCTACAATGTCTCCAGATCAACCACAGAGGATTTCCCGCTCAGGCTGCTGTCGGCTGCTCCCTCCCAGACATCTGTGTACTTC |
| CDR3 | TGTGCCAGCAGCCGGGACAGGGTAAATCAGCCCCAGCATTTT |
| FWR4 | GGTGATGGGACTCGACTCTCCATCCTAG |

 Converting this to a FASTA file, the inputs would look like this using 20 bp of each framework region:

```
>Clonotype1
CCCAGACATCTGTGTACTTCTGTGCCAGCAGCCGGGACAGGGTAAATCAGCCCCAGCATTTTGGTGATGGGACTCGACTCTC
```

</LinkableSection>

<LinkableSection id={"barcode"} title={"Barcode detection"}>

Xenium In Situ chemistry can detect ssDNA or ssRNA at sufficient copy number. We recommend at least 2-4 copies per cell, but ideally ≥ 10 copies. The ideal number of copies per cell will depend on the proportion of cells expressing your barcode, the efficiency of the probe, and the importance that every cell contains the barcode you would like to detect.

A common use case for barcode detection is lineage tracing. Some use cases involve multiple barcodes in a combinatorial fashion. This is possible to read out with Xenium In Situ, however the probability that all of the events happen in a given cell decreases as the number of individual events that must be detected in a single cell increases.

Placing multiple copies of the same barcode on your construct will increase sensitivity by boosting the effective copy number. If you want to design probes in this fashion, it is ideal to put 50 bp of space between each barcode copy.

</LinkableSection>

Advanced Custom Design

Example file formats for advanced custom target sequence information.

Xenium Advanced Custom Design Sequence Information

**This step is _optional_ and only applies to species standalone custom or advanced custom panel designs for [Xenium v1 panels](/support/software/xenium-panel-designer/latest/tutorials/pre-designed-xenium-v1)**. This step is **not** currently offered in the **Xenium Prime** panel design workflow - please submit requests in the Xenium Panel Designer and 10x support will work with you to finalize Xenium Prime advanced custom designs.

<SupportCallout level={"warning"}>
<Text as={"span"}>
{"While no impact on assay performance is anticipated, 10x Genomics does not support or experimentally validate the use of custom probes, and thus cannot guarantee that custom probes will successfully detect their targets."}
</Text>
</SupportCallout> 

This is the final, and optional, step of the [Request species standalone or advanced custom panels](/support/software/xenium-panel-designer/latest/tutorials/xenium-panel-design-workflow-guide#submit-request) workflow before submitting the request to a 10x bioinformatician.

To specify RNA-binding sequences for advanced custom probe sequences, create a CSV file formatted as specified in the [Species Standalone Custom and Advanced Custom Panel Design for Xenium In Situ Technical Note](/support/in-situ-gene-expression/documentation/steps/panel-design/species-standalone-custom-and-advanced-custom-panel-design-for-xenium-in-situ). This CSV file can be uploaded to the Xenium Panel Designer (see Provide Sequences step below) or you can work with your 10x bioinformatics representative to generate it.

<Image src={'https://cdn.10xgenomics.com/image/upload/v1706557124/software-support/Xenium-panels/xpd_provide_seqs.png'}/>

RNA-Binding Domains

Submitting RNA-binding sequences for Xenium v1 advanced custom designs in Xenium Panel Designer.

Specifying RNA-Binding Domains for Xenium v1 Panels

10x Genomics Xenium Panel Designer is an app for designing custom panels.

Overview

Tutorials

Advanced

FAQs

Release Notes

Datasets

Xenium Panel Designer

Introduction

Learn about pre-designed and custom panel design options to decide which is best-suited for your research.

Choose Design Option

Glossary of concepts important for understanding Xenium panel design.

Design Concepts and Terms

Walk through demonstrations of common Xenium Panel Designer use cases

Xenium Panel Designer Examples

Pre-designed Panels

Metadata for pre-designed Xenium v1 panels.

Xenium v1 Panel Info

Metadata for pre-designed Xenium Prime 5K panels.

Xenium Prime 5K Panel Info

Guidance for generating add-on, standalone custom, and advanced custom panel designs with the Xenium Panel Designer tool.

XPD Workflow Guide

Options for creating or selecting a single cell reference for custom panel design.

Create Single Cell Reference

Options for creating a gene list for custom panel design.

Create Gene List

Description of panel design summary HTML.

Interpret Xenium Panel Design Summary

Finalize Panel Design

Panel Part Numbers

Quick reference list for Xenium v1 pre-designed and custom panel part numbers.

Xenium v1 Panel PNs

Quick reference list for Xenium Prime 5K pre-designed and custom panel part numbers.

Xenium Prime 5K Panel PNs

Order a 10x Genomics pre-designed, off-the-shelf panel or design a custom panel with the Xenium Panel Designer app to perform Xenium In Situ Gene Expression analyses. Combine custom targets with pre-designed panels or build a standalone custom panel for maximum flexibility. Sign in to your existing 10x Cloud account or create a new account to get started today.

What is the Xenium Panel Designer?

Use the Xenium Panel Designer app to request custom panel designs. First, choose your custom panel design option. Then read the panel design request workflow guide to follow either the standard or advanced workflow.

Start Panel Request

Tell us about your panel request and enter a design ID if you have one.

Add Sample Info

Add on to a pre-designed panel or design a standalone custom panel. Select the panel type and number of targets.

Select Panel Type

Reference datasets are used to predict highly expressed genes that can cause optical crowding. For optimal results, use a dataset that closely aligns with your sample.

Provide Reference Datasets

Submit a list of custom genes to request for your custom panel design. Genes should be ranked in priority order from most to least important. In the standard workflow, the panel designer app will clean up the custom genes list and then generate a design for you to review.

Add Custom Genes

For advanced target or species standalone custom design requests, submit additional sequence information. This is not necessary for standard workflow design requests.

Advanced Workflow Step

Identify potential issues with your current panel and view the optimized panel design that incorporates all our recommendations.

Review Recommendations

If satisfied with the design, finalize to complete request. Please note that after designs are finalized, no further changes can be made to your panel design.

Review and Finish

Find answers to frequently asked questions about design ID, custom designs, and reference data.

We regularly add new features to the 10x Genomics Xenium Panel Designer. Find details about the updates and improvements on this page.

Access free, publicly available data generated with Xenium In Situ Gene Expression solutions.